LOC100329813

Ensembl ID:
ENSDARG00000092902
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24573 Nonsense Mutation detected in F1 DNA During 2014
sa24572 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133338 Nonsense 1026 1939 21 36
Genomic Location:
Chromosome 24 (position 42350613)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGACCTCCAGAGTGAGGAAGACAAAGTCAACACACTCACCAAAGCC[A/T]AAGCCAAGCTGGAGCAGCAAGTGGATGATGTGGGTAGTTTGTTGAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133338 Nonsense 1348 1939 27 36
Genomic Location:
Chromosome 24 (position 42348798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCACATGCAGTTCAGTCTGCTCGTCATGATTCTGACCTGCTGAGGGAA[C/T]AATATGAAGAGGAGCAGGAAGCCAAAGCTGAGCTGCAGCGTAGTCTGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xbu3miqx