LOC100329813

Ensembl ID:
ENSDARG00000092902
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32501 Nonsense Mutation detected in F1 DNA During 2016
sa24573 Nonsense Mutation detected in F1 DNA During 2016
sa24572 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133338 Nonsense 523 1939 13 36
Genomic Location (Zv9):
Chromosome 24 (position 42352944)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41069985
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACGTTCATTGACTTCGGCATGGACTTACAGGCTTGTATTGATCTCATT[G/T]AAAAGGTGCGTGAGCAAAGTCATCTCGTTTTGAAACTTAATAGCTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133338 Nonsense 1026 1939 21 36
Genomic Location (Zv9):
Chromosome 24 (position 42350613)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 41067650
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACGACCTCCAGAGTGAGGAAGACAAAGTCAACACACTCACCAAAGCC[A/T]AAGCCAAGCTGGAGCAGCAAGTGGATGATGTGGGTAGTTTGTTGAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24572
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133338 Nonsense 1348 1939 27 36
Genomic Location (Zv9):
Chromosome 24 (position 42348798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCACATGCAGTTCAGTCTGCTCGTCATGATTCTGACCTGCTGAGGGAA[C/T]AATATGAAGAGGAGCAGGAAGCCAAAGCTGAGCTGCAGCGTAGTCTGTCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link