si:dkey-105h11.2

Ensembl ID:
ENSDARG00000092898
ZFIN ID:
ZDB-GENE-091117-34
Mouse Orthologue:
BC055004
Mouse Description:
cDNA sequence BC055004 Gene [Source:MGI Symbol;Acc:MGI:3584036]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa671 Nonsense F2 line generated During 2017
sa11495 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa671
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141504 Nonsense 282 544 4 7
Genomic Location (Zv9):
Chromosome 24 (position 5876835)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5764127
KASP Assay ID:
554-0579.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTGAGAGACCWAAGARACTTTCTTGTGACAAACTGGTTTATCACTCA[A/T]GAGGAGGTCTGGAAAACCCATTAGATGCTTTTGAGAAGCWAATTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11495
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141504 Essential Splice Site 299 544 5 7
Genomic Location (Zv9):
Chromosome 24 (position 5877144)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 5764436
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAAAAGGAAATTTGCATAACTCTTTCMTGKTTTCTTTGCTTTAGACA[G/A]AACGGAGARATGCAGACCTGGTCTGACRACACCAGTACCTGCAGGTTTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link