si:dkey-193b15.5

Ensembl ID:
ENSDARG00000092883
ZFIN ID:
ZDB-GENE-070912-413
Description:
hypothetical protein LOC565664 [Source:RefSeq peptide;Acc:NP_001122200]
Human Orthologues:
IFI44, IFI44L
Human Descriptions:
interferon-induced protein 44 [Source:HGNC Symbol;Acc:16938]
interferon-induced protein 44-like [Source:HGNC Symbol;Acc:17817]
Mouse Orthologues:
H28, Ifi44
Mouse Descriptions:
histocompatibility 28 Gene [Source:MGI Symbol;Acc:MGI:95975]
interferon-induced protein 44 Gene [Source:MGI Symbol;Acc:MGI:2443016]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa541 Nonsense F2 line generated During 2017
sa30825 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39883 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa541
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008322 Nonsense 11 445 2 8
Genomic Location (Zv9):
Chromosome 2 (position 36634714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36931424
KASP Assay ID:
554-0451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGATTTCAGATCATCATCATGAGCACCGTCACATCTAGCTTGACTGAA[C/T]AGCAGAAGAAGAAGCTCTTCACTTTATTCAACCATGCCAAATCCAGCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30825
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008322 Essential Splice Site 351 445 7 8
ENSDART00000008322 Essential Splice Site 351 445 7 8
Genomic Location (Zv9):
Chromosome 2 (position 36628363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36925073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCTACACTATACACTTTAATTGCATCTATGGTGTTGATCTGCTTATC[A/C]GGAATTCCTCAGTTGGTTCTGTTGACTAAGGTGGATGAAGCCTGCCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39883
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008322 Essential Splice Site 351 445 7 8
ENSDART00000008322 Essential Splice Site 351 445 7 8
Genomic Location (Zv9):
Chromosome 2 (position 36628363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 36925073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCTACACTATACACTTTAATTGCATCTATGGTGTTGATCTGCTTATC[A/C]GGAATTCCTCAGTTGGTTCTGTTGACTAAGGTGGATGAAGCCTGCCCCTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link