si:ch211-2i17.1

Ensembl ID:
ENSDARG00000092860
ZFIN ID:
ZDB-GENE-090313-112
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A6F0]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39621 Nonsense Mutation detected in F1 DNA During 2017
sa30583 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39621
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136503   None 171 None 4
ENSDART00000142191 Nonsense 146 176 4 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25836125)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26176342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGCAGAAGATGAGGAGGAGAAAAACATCAAAGCCCCATTCTGCTTTA[C/T]GACAGCATCTTCTGTCCCTCCAGCAGCAAGTGGCAGCACTACAGGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136503 Nonsense 96 171 3 4
ENSDART00000142191   None 176 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 25810075)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26150292
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTCTCAAGAGAAGATTGACAGTTGCCACTGCAGAAAAAACTCAGCAG[G/T]AGACAAGCAGCCGCAAACTCAAAGAGGAGCTTCAGAAAAAGGTGCAAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link