si:ch1073-126c3.2

Ensembl ID:
ENSDARG00000092858
ZFIN ID:
ZDB-GENE-030131-4602
Description:
si:ch1073-126c3.2 [Source:RefSeq peptide;Acc:NP_001138258]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42180 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131467 Nonsense 213 221 6 6
ENSDART00000135535   None 117 6 6

The following transcripts of ENSDARG00000092858 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 20674573)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 20404925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTTTAAATCTGAGCTGGCTAAAGTGGAGACCACAGAATCAGAGTCTACC[A/T]AACTTCTCTGTGGCAACATCAACAACTAAATCTAAAATGTAGATCAAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link