si:ch211-87h14.4

Ensembl ID:
ENSDARG00000092844
ZFIN ID:
ZDB-GENE-081104-241
Description:
Novel protein similar to H.sapiens CPAMD8, C3 and PZP-like, alpha-2-macroglobulin domain containing
Human Orthologue:
CPAMD8
Human Description:
C3 and PZP-like, alpha-2-macroglobulin domain containing 8 [Source:HGNC Symbol;Acc:23228]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37504 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43829 Essential Splice Site Mutation detected in F1 DNA During 2017
sa43830 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37504
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419   None 216 None 5
ENSDART00000143592 Essential Splice Site 57 587 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21582140)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21235388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGATGCAAGGCCACACGTACAACAAATCGTTTGAAGTGCAGAAGTACGG[T/G]AAGCATTTATGTATTAATATATACTGTAAAATGTAAATAGAAGTAGAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43829
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419   None 216 None 5
ENSDART00000143592 Essential Splice Site 520 587 None 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21586645)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21239893
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCCATGGCACTGGGACATCACTAAAGATGCCCGTTTTGCTTTTACGG[T/A]GAGGACATGACTTTCTCCACTTCCCCGTATTGTTTTAAGCTCAGGCAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43830
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142419   None 216 None 5
ENSDART00000143592 Nonsense 564 587 12 13

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 21587647)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 21240895
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTGCGTTTCAACCACACACCTCTACCCTGGTGGCAGCTATGCACTCC[C/T]GATCTGGGACACGGTACACATGCTCACAGTGTCTGAAATTTTAAGGTTAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link