metap2

Ensembl ID:
ENSDARG00000092768
ZFIN ID:
ZDB-GENE-030131-2172
Human Orthologue:
METAP2
Human Description:
methionyl aminopeptidase 2 [Source:HGNC Symbol;Acc:16672]
Mouse Orthologue:
Metap2
Mouse Description:
methionine aminopeptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1929701]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37984 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37984
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020607 Nonsense 158 476 5 11
ENSDART00000126188 Nonsense 158 476 5 12

The following transcripts of ENSDARG00000092768 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 3292094)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 3111380
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGCACGGCTGCTTCACGAACGAGCAACGAAGAGAAAAAGTTTTTGGAT[C/T]AGGCGAATGAGGACATGTGGAATGATTTCCGGCAGGCCGCCGAGGCTCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link