si:ch211-150o23.2

Ensembl ID:
ENSDARG00000092746
ZFIN ID:
ZDB-GENE-060503-386
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S5A4]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa490 Essential Splice Site Confirmed mutation in F2 line During 2017

Mutation Details

Allele Name:
sa490
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131276 Essential Splice Site 61 161 3 7

The following transcripts of ENSDARG00000092746 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 18307916)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 17752804
KASP Assay ID:
554-0343.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCAAAAAGCCTCAACCTCAATCTGACAGGACATATTACAGGGAGGAAGG[T/C]AAAGCTTACGTAACAATCAACACACAACACATAAATAATAATGTCTGTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link