ftr31

Ensembl ID:
ENSDARG00000092745
ZFIN IDs:
ZDB-GENE-050417-159, ZDB-GENE-070912-107
Description:
Novel protein similar to H.sapiens tripartite motif-containing [Source:UniProtKB/TrEMBL;Acc:B0S651]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31304 Nonsense Available for shipment Available now
sa25951 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31304
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143980 Nonsense 67 506 1 6
Genomic Location (Zv9):
Chromosome 2 (position 60056745)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59133536
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTACAGCTGCCCTCAGTGCAGACAGACCTTCAGCCCCAGACCCGCTT[T/A]AGCTAAAAACACCATGCTGGCTGAGATGGTGGAGAAACTGCGGAAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25951
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143980 Essential Splice Site 198 506 2 6
Genomic Location (Zv9):
Chromosome 2 (position 60055535)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 59132326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTCATGTTATATGAGATGTATATTGAGTGTAAAGTGTGAATCCTGCA[G/A]AGACGCCTAAAGAACATCCAGAGCAGTTTCCAGCAGAGACTCCAGGAGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link