si:dkey-189e1.4

Ensembl ID:
ENSDARG00000092741
ZFIN ID:
ZDB-GENE-091204-343
Human Orthologue:
MLPH
Human Description:
melanophilin [Source:HGNC Symbol;Acc:29643]
Mouse Orthologue:
Mlph
Mouse Description:
melanophilin Gene [Source:MGI Symbol;Acc:MGI:2176380]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7514 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144066 Missense 13 117 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 10899687)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 10987090
KASP Assay ID:
554-4289.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGGTGGATGTGGAGCAGAAGTAYTCTGCTGCGTCTTTATGCAGCATCA[C/T]CACAGAGGTTCTGAAGGTCCTAAACGCCACAGAGGATTTGCTTGGTGARG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link