taar13a

Ensembl ID:
ENSDARG00000092734
ZFIN IDs:
ZDB-GENE-041014-68, ZDB-GENE-070424-256
Description:
trace amine associated receptor 64 [Source:RefSeq peptide;Acc:NP_001076571]
Mouse Orthologue:
Taar4
Mouse Description:
trace amine-associated receptor 4 Gene [Source:MGI Symbol;Acc:MGI:2685072]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45717 Nonsense Mutation detected in F1 DNA During 2018
sa37149 Nonsense Mutation detected in F1 DNA During 2018
sa4926 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa45717
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 113 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46148789)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273184
GRCz11 20 46176904
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTGGTACTATGGAGAGACCTTCTGTATGCTTCACTCAACTTTTGACT[T/A]GTTCCTCACATCAGTGTCTATTTTGCATCTTGTTTGTATTGCTGTTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37149
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 139 341 1 1
Genomic Location (Zv9):
Chromosome 20 (position 46148712)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273261
GRCz11 20 46176981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTGTTTGTATTGCTGTTGATCGACATCAGGCTGTATGTTATCCGCTT[C/T]AGTACCCAACAAGAATAACCATATCTGTTGCATGGGTCATGGTGATGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4926
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140951 Nonsense 326 341 1 1

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 46148151)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 46273822
GRCz11 20 46177542
KASP Assay ID:
554-3551.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGCTTTTTCTACCCATGGTTTAGAAAAACCCTTTATCTCATTATAACA[A/T]GAAGAATATTTGAACCAAACTCATCTGATATCAATGTTTTCACTGTGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link