gbgt1l2

Ensembl ID:
ENSDARG00000092718
ZFIN ID:
ZDB-GENE-060531-71
Description:
hypothetical protein LOC566487 [Source:RefSeq peptide;Acc:NP_001120986]
Mouse Orthologue:
Abo
Mouse Description:
ABO blood group (transferase A, alpha 1-3-N-acetylgalactosaminyltransferase, transferase B, alpha 1-

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20399 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20399
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140766 Nonsense 113 301 6 6
Genomic Location (Zv9):
Chromosome 5 (position 25408089)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 23235354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTATATCTTCACCGACCATCCAGAAGAGGTTCCTGATGTGAAACTGGGT[G/T]AAGGACATCAGTTGACGGTGATGACAGTTGGTAGTTCTAACAGATGGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link