LOC568975

Ensembl ID:
ENSDARG00000092704

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15074 Nonsense Available for shipment Available now
sa38908 Nonsense Mutation detected in F1 DNA During 2016
sa42095 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38907 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15074
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145643 Nonsense 62 1106 1 15
Genomic Location:
Chromosome 12 (position 47429079)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGATGACACCATGGTTGAATGGAGCGGCTGGTATCGGCTGTATCTGAMT[G/T]GACAAAGTGCCCAGATGTCTGAGTGGTGTATGAGTTCAATGGGCTGTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145643 Nonsense 548 1106 5 15
Genomic Location:
Chromosome 12 (position 47426825)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACTTTCACATCCCACCCTATAAGAGTCAAAGCCTGTCCTGGAGATTA[T/G]TATGTGTATGAGTTTGTACAGCCGAGAACTCACTCAGCTTACTGTGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42095
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145643 Essential Splice Site 719 1106 7 15
Genomic Location:
Chromosome 12 (position 47422364)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCTATGAGTTTGTGAGGCCGACCACCTGCAATTTAGCATACTGTGCAG[G/A]TACTGGACACACATTTAACTCTGCCTTCTGTTTATGTTAGAGATGATGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145643 Nonsense 888 1106 11 15
Genomic Location:
Chromosome 12 (position 47420412)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGTGAGAATCCTGAAGCTTTCTTTCAGCTGTGTTTATCCTCAAACA[C/T]AAACACTTTCCATGAACGTGGAGATCAACCCAGTGCAGAGGTGCCACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link