si:dkey-197d18.1

Ensembl ID:
ENSDARG00000092692
ZFIN ID:
ZDB-GENE-041014-155
Description:
Novel protein similar to vertebrate PIM family oncogenes [Source:UniProtKB/TrEMBL;Acc:Q5RI90]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43519 Nonsense Mutation detected in F1 DNA During 2017
sa37141 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43519
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100697 Nonsense 32 463 1 7
ENSDART00000137422   None 202 None 4
Genomic Location (Zv9):
Chromosome 20 (position 43493823)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43564982
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGAACCATCAATTCCACCGTCTCAGGTCAAGATAAAAACTTCGACCGT[C/T]AAGAAGAAGGATTGGTCACGGGATCCAACGTGGCCACCAGTGATGGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37141
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000100697 Essential Splice Site 46 463 1 7
ENSDART00000137422   None 202 None 4
Genomic Location (Zv9):
Chromosome 20 (position 43493777)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 43564936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCAAGAAGAAGGATTGGTCACGGGATCCAACGTGGCCACCAGTGATG[G/A]TAAATAATGTTTTGTGTTATAAGAACATGTTGCTCATTTTGGATGCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link