cyp27c1

Ensembl ID:
ENSDARG00000092660
ZFIN ID:
ZDB-GENE-080204-68
Description:
cytochrome P450, family 27, subfamily C, polypeptide 1 [Source:RefSeq peptide;Acc:NP_001106808]
Human Orthologue:
CYP27C1
Human Description:
cytochrome P450, family 27, subfamily C, polypeptide 1 [Source:HGNC Symbol;Acc:33480]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10938 Nonsense Available for shipment Available now
sa14231 Nonsense Available for shipment Available now
sa2308 Nonsense F2 line generated During 2014
sa7591 Missense, Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa10938
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081309 Nonsense 162 468 4 9
ENSDART00000144335 Nonsense 265 571 4 9
Genomic Location:
Chromosome 6 (position 8151429)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATGATGAGTAAAACAWATTTGACTCTTTCTTAGGTGTTGCAACTATTT[T/A]ATACGAGACTCGCCTGGGCTGCTTGGAAAATGAAATTCCCAAGATGAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081309 Nonsense 181 468 4 9
ENSDART00000144335 Nonsense 284 571 4 9
Genomic Location:
Chromosome 6 (position 8151487)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCGCCTGGGCTGCTTGGAAAATGAAATTCCCAAGATGAGTCAGGAGTA[C/A]ATYACTGCATTACACCTCHTGTTCAGCTCCTTTAAGACCACCATGTACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2308
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081309 Nonsense 211 468 4 9
ENSDART00000144335 Nonsense 314 571 4 9
Genomic Location:
Chromosome 6 (position 8151575)
KASP Assay ID:
554-3010.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCATGTACGCTGGTGCCATTCCCAAATGGCTGCGTCCCATCATTCCC[A/T]AACCCTGGGAGGAATTCTGCAGCTCATGGGACGGCCTCTTTAAATTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7591
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081309 Missense, Splice Site 337 468 7 9
ENSDART00000144335 Missense, Splice Site 440 571 7 9
Genomic Location:
Chromosome 6 (position 8154558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGTTTAAAACAAAACATTATTTAACTTCATCCCTCTACTGCACACAGG[C/T]TTTTYCCTGTTCTCCCTGGAAATGGACGTGTTACACATGATGATCTGATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9r21z7to