si:ch211-51e8.2

Ensembl ID:
ENSDARG00000092635
ZFIN ID:
ZDB-GENE-091118-125
Human Orthologues:
EBF1, EBF2, EBF3
Human Descriptions:
early B-cell factor 1 [Source:HGNC Symbol;Acc:3126]
early B-cell factor 2 [Source:HGNC Symbol;Acc:19090]
early B-cell factor 3 [Source:HGNC Symbol;Acc:19087]
Mouse Orthologues:
Ebf1, Ebf2, Ebf3
Mouse Descriptions:
early B-cell factor 1 Gene [Source:MGI Symbol;Acc:MGI:95275]
early B-cell factor 2 Gene [Source:MGI Symbol;Acc:MGI:894332]
early B-cell factor 3 Gene [Source:MGI Symbol;Acc:MGI:894289]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8686 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8686
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140184 Essential Splice Site 172 195 6 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 32938983)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 33938676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCACAATACTGCTTTCTTAGCTAATTTTGTTTTGTTGTTGTCCTTTTA[G/A]TCGATGCTGCGACAAAAAGAGTTGTGGAAACCGCAATGAGACACCCTCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link