si:ch73-92e7.3

Ensembl ID:
ENSDARG00000092605
ZFIN IDs:
ZDB-GENE-080219-42, ZDB-GENE-081030-5
Description:
Novel protein (Zgc:174712) [Source:UniProtKB/TrEMBL;Acc:B8JM00]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37400 Nonsense Mutation detected in F1 DNA During 2017
sa3164 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37400
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134277 Nonsense 146 336 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1771616)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2512706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCTTAATCAACACATGAAGATCCACACTGGAGAGAGACCACACTATTG[T/A]GATCAATGCGGCAGAACATTTTTGAGGACTTCAGAACTGAGGAGACATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3164
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134277 Nonsense 219 336 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1771833)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2512923
KASP Assay ID:
554-2719.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCATTGAGTGTGGGAAGAGTTTTATTAATGCACAAGTACTGCAAATACAC[C/T]AGAGGATCCACACCGGAGAGAAACCGTACAAGTGTTCACACTGCGACAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link