si:ch73-25f10.1

Ensembl ID:
ENSDARG00000092566
ZFIN ID:
ZDB-GENE-100921-16
Description:
Novel protein containing a galactose binding lectin domain [Source:UniProtKB/TrEMBL;Acc:A3KQ74]
Human Orthologues:
C21orf63, FAM176A, FAM176B
Human Descriptions:
chromosome 21 open reading frame 63 [Source:HGNC Symbol;Acc:13239]
family with sequence similarity 176, member A [Source:HGNC Symbol;Acc:25816]
family with sequence similarity 176, member B [Source:HGNC Symbol;Acc:25558]
Mouse Orthologues:
4931408A02Rik, Fam176a, Fam176b
Mouse Descriptions:
family with sequence similarity 176, member A Gene [Source:MGI Symbol;Acc:MGI:2385247]
family with sequence similarity 176, member B Gene [Source:MGI Symbol;Acc:MGI:1922063]
RIKEN cDNA 4931408A02 gene Gene [Source:MGI Symbol;Acc:MGI:1918217]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16560 Essential Splice Site Available for shipment Available now
sa23538 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16560
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140698 Essential Splice Site 144 245 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28034974)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27965086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACATTTGCCTGCTTCAGTGTTTTGAATGTTNNNTCTTGACTCTTCTAC[A/C]GGTTCAAGTGCAGTCTGTGAAAATGCCATTGCTAACTTCAAATGTGGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23538
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140698 Nonsense 206 245 8 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 28034577)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 27964689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTAATTCTATGGGTTTCACTTAACTTGTTTTTCTGTTTGTGTAGATG[T/A]GAAGGGAAGAACAGCTGCTCCATTTCAGCCTCCAATGGGGTCTTCTCAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link