ENSDARG00000092507

Ensembl ID:
ENSDARG00000092507
Human Orthologues:
BX248098.1, ZNF107, ZNF160, ZNF197, ZNF208, ZNF616, ZNF658, ZNF721, ZNF729, ZNF808, ZNF836, ZNF841, ZNF845, ZNF91, ZNF99
Human Descriptions:
zinc finger protein 107 [Source:HGNC Symbol;Acc:12887]
zinc finger protein 160 [Source:HGNC Symbol;Acc:12948]
zinc finger protein 197 [Source:HGNC Symbol;Acc:12988]
zinc finger protein 208 [Source:HGNC Symbol;Acc:12999]
zinc finger protein 616 [Source:HGNC Symbol;Acc:28062]
zinc finger protein 658 [Source:HGNC Symbol;Acc:25226]
Zinc finger protein 658B [Source:UniProtKB/Swiss-Prot;Acc:Q4V348]
zinc finger protein 721 [Source:HGNC Symbol;Acc:29425]
zinc finger protein 729 [Source:HGNC Symbol;Acc:32464]
zinc finger protein 808 [Source:HGNC Symbol;Acc:33230]
zinc finger protein 836 [Source:HGNC Symbol;Acc:34333]
zinc finger protein 841 [Source:HGNC Symbol;Acc:27611]
zinc finger protein 845 [Source:HGNC Symbol;Acc:25112]
zinc finger protein 91 [Source:HGNC Symbol;Acc:13166]
zinc finger protein 99 [Source:HGNC Symbol;Acc:13175]
Mouse Orthologues:
A530054K11Rik, AA987161, Zfp748
Mouse Descriptions:
expressed sequence AA987161 Gene [Source:MGI Symbol;Acc:MGI:2145180]
RIKEN cDNA A530054K11 gene Gene [Source:MGI Symbol;Acc:MGI:3036250]
zinc finger protein 748 Gene [Source:MGI Symbol;Acc:MGI:1916455]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3923 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000148167 Nonsense 417 898 7 7
Genomic Location:
Chromosome 15 (position 640920)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGAAAGTCCACATGAGAGTTCACACTGGAGAGAAGCCTTTCGCCTGC[C/T]AACAATGTGGACAGGGTTTTACCCAAAAAGGAAACCTCAGTGCCCACATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7qit3kgl