si:dkey-149i17.8

Ensembl ID:
ENSDARG00000092491
ZFIN ID:
ZDB-GENE-070912-375

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39833 Nonsense Mutation detected in F1 DNA During 2017
sa18395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077349 Nonsense 130 256 3 5
ENSDART00000140999 Nonsense 88 164 1 2
Genomic Location (Zv9):
Chromosome 2 (position 24670590)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25245367
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGAAACAGGTCGTATCCGCAGCTCAAACGTGCTGCCAAAGAAAAGTGT[T/A]ACACCGAGATATCAAGCTGGAGAACCTCCTGATTAAGCCGGACACCCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077349 Nonsense 209 256 4 5
ENSDART00000140999   None 164 None 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24666816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25241593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCTCGGAGTACTCCTTTATGCGATGATGTGTGGGGAGTTTCCAAAT[C/T]GACACGACCTGCAAATGATCAGATATAACATCTGGACCAAAGATCACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link