KHNYN

Ensembl ID:
ENSDARG00000092488
Description:
KH and NYN domain containing [Source:HGNC Symbol;Acc:20166]
Human Orthologue:
KHNYN
Human Description:
KH and NYN domain containing [Source:HGNC Symbol;Acc:20166]
Mouse Orthologue:
Khnyn
Mouse Description:
KH and NYN domain containing Gene [Source:MGI Symbol;Acc:MGI:2451333]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1080 Missense, Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa1080
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140303 Missense 332 678 6 13
ENSDART00000143762 Nonsense 454 801 8 15
Genomic Location (Zv9):
Chromosome 7 (position 1525131)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 1252275
KASP Assay ID:
554-0982.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACGCGCACTYCAATGGGCTCAGAAATGGCAGCCAGCAAGCGGATT[G/A]GACAACTGAGCAAAATTCAAGGTCAGATTCGGTTCATGACAATATCCGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link