thbs2a

Ensembl ID:
ENSDARG00000092466
ZFIN ID:
ZDB-GENE-020708-2
Human Orthologue:
THBS2
Human Description:
thrombospondin 2 [Source:HGNC Symbol;Acc:11786]
Mouse Orthologue:
Thbs2
Mouse Description:
thrombospondin 2 Gene [Source:MGI Symbol;Acc:MGI:98738]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2696 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa2696
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142392 Essential Splice Site 809 1175 15 22
ENSDART00000146432 Essential Splice Site 802 1171 14 20
Genomic Location:
Chromosome 13 (position 36067534)
KASP Assay ID:
554-2944.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGACGGTAATGGCGAAGGGGACGCCTGTGCTGTTGACATTGATGGAGATG[G/A]TGAGAAACTACTAGAAACTGAAAACTATCNNTTTTTTTTGTCCTGTGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yuoc7ui6