si:dkey-173l11.3

Ensembl ID:
ENSDARG00000092450
ZFIN ID:
ZDB-GENE-081104-9

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41031 Essential Splice Site Mutation detected in F1 DNA During 2017
sa14895 Nonsense Available for shipment Available now
sa1461 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41031
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Essential Splice Site 74 405 2 8
Genomic Location (Zv9):
Chromosome 7 (position 56117914)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52936596
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAAAGTCCACAAAGATCACCTTCACAAAGGAGAGAGACTCGGGAGAGG[T/A]AAGCGGTGTACTTCTAATTATACTAAAGAAGCAGCTAAACATTGAGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14895
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Nonsense 149 405 3 8
Genomic Location (Zv9):
Chromosome 7 (position 56115437)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52939073
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGAGTTGAGCGTGTCGATTATCATAAGGATCATGACGTRAATACAT[T/A]AATGAATACTTCCTCTGTACAGGTATAGATATTACTTCCTAAAACTGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000044592 Nonsense 235 405 5 8
Genomic Location (Zv9):
Chromosome 7 (position 56114714)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 52939796
KASP Assay ID:
554-1386.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTGGTGAAGGAGCAGATCAGGACCCTAAGGGAATTTTTCAAATAGAC[A/T]GACTATCAGGATGGGTCAGTGTAACTCAGCAACTTGACAGAGAAAAAAAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link