si:ch211-213a13.2

Ensembl ID:
ENSDARG00000092442
ZFIN ID:
ZDB-GENE-050208-551
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LXW5]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37422 Essential Splice Site Mutation detected in F1 DNA During 2017
sa24075 Nonsense Available for shipment Available now
sa29716 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37422
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135448 Essential Splice Site 56 147 1 3
ENSDART00000144914   None 376 None 7
Genomic Location (Zv9):
Chromosome 22 (position 8983866)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9014942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAGATCTGTGATGGACTGAAGAAATCTACGCTTAAAATACTGAAG[T/C]GAGTGCATTTACACATCTCAGATGAAACAGTATAGTAAACATTAACCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24075
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135448   None 147 None 3
ENSDART00000144914 Nonsense 27 376 1 7
Genomic Location (Zv9):
Chromosome 22 (position 8989063)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9020139
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGGACAAACGGGAGTGAAGGAGCTCACTGAGTTACTACAGGATCGATA[T/A]ACTAAATTGAAGACTCTCAGGTGAAACATGAAAAAAAATATGTATTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29716
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135448   None 147 None 3
ENSDART00000144914 Nonsense 169 376 4 7
Genomic Location (Zv9):
Chromosome 22 (position 8992064)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9023140
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCTCTGACAGATGACTGTTGTTCTGCTGTGACTTCAGCTCTGAAAT[C/A]AAACCCATCACACCTGAGAGAACTGAATCTCAGTGGGAATCAAATAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link