B8JKB7_DANRE

Ensembl ID:
ENSDARG00000092430
Description:
Novel protein similar to H.sapiens MYO1B, myosin IB (MYO1B) [Source:UniProtKB/TrEMBL;Acc:B8JKB7]
Human Orthologue:
MYO1B
Human Description:
myosin IB [Source:HGNC Symbol;Acc:7596]
Mouse Orthologue:
Myo1b
Mouse Description:
myosin IB Gene [Source:MGI Symbol;Acc:MGI:107752]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5530 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa14798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa5530
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186 Splice Site, Nonsense 42 166 1 6
ENSDART00000131398 Splice Site, Nonsense 101 225 2 7
ENSDART00000134797 Splice Site, Nonsense 103 313 2 9
Genomic Location:
Chromosome 9 (position 16362925)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGTCATTCATTGAGAATCTAAAAAAGCGATTCGATCACAATGAGATCTA[T/A]GTAAGTATTTGCTTAAAATCAATTTATCTTTATTTGGATGTGTTCTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186 None None 166 None 6
ENSDART00000131398 None None 225 None 7
ENSDART00000134797 Essential Splice Site 279 313 None 9

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 9 (position 16411507)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCCYTGTCTTAYTGTTACTGTTAAACTCTAMTTGTAATTGTATTTC[A/T]GAAAAACTGAAGCTGGACCGGGACTTCAGCAAATATAACTACCTTAGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/4q7n5t2h