B8JKB7_DANRE

Ensembl ID:
ENSDARG00000092430
Description:
Novel protein similar to H.sapiens MYO1B, myosin IB (MYO1B) [Source:UniProtKB/TrEMBL;Acc:B8JKB7]
Human Orthologue:
MYO1B
Human Description:
myosin IB [Source:HGNC Symbol;Acc:7596]
Mouse Orthologue:
Myo1b
Mouse Description:
myosin IB Gene [Source:MGI Symbol;Acc:MGI:107752]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077186   None 166 None 6
ENSDART00000131398   None 225 None 7
ENSDART00000134797 Essential Splice Site 279 313 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 16411507)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 16232145
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTACCCYTGTCTTAYTGTTACTGTTAAACTCTAMTTGTAATTGTATTTC[A/T]GAAAAACTGAAGCTGGACCGGGACTTCAGCAAATATAACTACCTTAGCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link