TRIM35 (12 of 41)

Ensembl ID:
ENSDARG00000092407
Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Human Orthologue:
TRIM35
Human Description:
tripartite motif-containing 35 [Source:HGNC Symbol;Acc:16285]
Mouse Orthologue:
Trim35
Mouse Description:
tripartite motif-containing 35 Gene [Source:MGI Symbol;Acc:MGI:1914104]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17348 Nonsense Available for shipment Available now
sa2872 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa17348
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135053 Nonsense 55 348 1 6
Genomic Location:
Chromosome 16 (position 29075863)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTRGAGTGTCCTGTTTGCAGGAGACGATCGTCCAGAGATGATCCTCCTTG[T/A]AATCTTGTKTWGAAGAACTTGTGTGAGTCACTGACAGCAGACAGAGCTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2872
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135053 Nonsense 59 348 1 6
Genomic Location:
Chromosome 16 (position 29075874)
KASP Assay ID:
554-3236.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGCAGGAGACGATCGTCCAGAGATGATCCTCCTTGTAATCTTGTGT[T/A]GAAGAACTTGTGTGAGTCACTGACAGCAGACAGAGCTTCAGGGTCTGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/sl6pizzd