ryr1b

Ensembl ID:
ENSDARG00000092370
ZFIN ID:
ZDB-GENE-070705-417
Description:
Novel protein similar to H.sapiens ryanodine receptor [Source:UniProtKB/TrEMBL;Acc:A5WVM0]
Human Orthologue:
RYR1
Human Description:
ryanodine receptor 1 (skeletal) [Source:HGNC Symbol;Acc:10483]
Mouse Orthologue:
Ryr1
Mouse Description:
ryanodine receptor 1, skeletal muscle Gene [Source:MGI Symbol;Acc:MGI:99659]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8663 Essential Splice Site Mutation detected in F1 DNA During 2017
sa8792 Missense Mutation detected in F1 DNA During 2017
sa8832 Missense Mutation detected in F1 DNA During 2017
sa8908 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8663
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138061 Essential Splice Site 16 383 1 11

The following transcripts of ENSDARG00000092370 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 34076378)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35755534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGGCAGAAGGAGAGGGKGGAGATGAAGAGATCCAGTTCCTGCGGACGG[T/G]GAGTGATGCCTTCTTGACCCGCTTTGATTTYATAATAATAAGAAGGAKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11

The following transcripts of ENSDARG00000092370 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11

The following transcripts of ENSDARG00000092370 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8908
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11
ENSDART00000138061 Missense 379 383 11 11

The following transcripts of ENSDARG00000092370 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 33992223)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35671379
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTGCTTTAGATGCTAAAGCGGCTCGCCTGGGAACCATGAARAGAAGGG[T/G]AATGAAGCTCAGTTAATTCCAAACCACATGATAACAAAACATGTTTCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link