si:ch211-218c6.8

Ensembl ID:
ENSDARG00000092364
ZFIN ID:
ZDB-GENE-050419-103
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LUE1]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1885 Essential Splice Site, Missense Available for shipment Available now
sa748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1885
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142088 Essential Splice Site 22 125 1 3
ENSDART00000147377 Missense 99 146 3 3
Genomic Location (Zv9):
Chromosome 18 (position 16646137)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16997903
KASP Assay ID:
554-1875.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAAGCTTGTTGAATTACTGAAGAAAACAGGGGATGACCTAGACCAGAAG[G/T]TAATGGTCAGCAGTTTTGGTTTAGTGGRCAGTTTTGGATTACCCACTGAA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142088   None 125 None 3
ENSDART00000147377 Nonsense 130 146 3 3
Genomic Location (Zv9):
Chromosome 18 (position 16646232)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 16997998
KASP Assay ID:
554-0655.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGAATTAAATGCAGAKATGCATATTTTGGTCTATTTTTGCATATTTTG[G/A]TCTATTTTGAAGGACACAAGCCAAGTATACACTCACTGGCCMCTTTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link