ENSDARG00000092342

Ensembl ID:
ENSDARG00000092342
Human Orthologues:
ZFP62, ZNF268, ZNF585A, ZNF585B, ZNF624
Human Descriptions:
zinc finger protein 268 [Source:HGNC Symbol;Acc:13061]
zinc finger protein 585A [Source:HGNC Symbol;Acc:26305]
zinc finger protein 585B [Source:HGNC Symbol;Acc:30948]
zinc finger protein 62 homolog (mouse) [Source:HGNC Symbol;Acc:23241]
zinc finger protein 624 [Source:HGNC Symbol;Acc:29254]
Mouse Orthologues:
5430403G16Rik, Gm13212, Gm14124, Gm14295, Zfp26, Zfp27, Zfp619, Zfp62, Zfp658, Zfp788, Zfp808, Zfp873
Mouse Descriptions:
predicted gene 13212 Gene [Source:MGI Symbol;Acc:MGI:3651014]
predicted gene 14124 Gene [Source:MGI Symbol;Acc:MGI:3652002]
predicted gene 14295 Gene [Source:MGI Symbol;Acc:MGI:3709624]
RIKEN cDNA 5430403G16 gene Gene [Source:MGI Symbol;Acc:MGI:1924450]
zinc finger protein 26 Gene [Source:MGI Symbol;Acc:MGI:99173]
zinc finger protein 27 Gene [Source:MGI Symbol;Acc:MGI:99174]
zinc finger protein 619 Gene [Source:MGI Symbol;Acc:MGI:1917477]
zinc finger protein 62 Gene [Source:MGI Symbol;Acc:MGI:99662]
zinc finger protein 658 Gene [Source:MGI Symbol;Acc:MGI:2652821]
zinc finger protein 788 Gene [Source:MGI Symbol;Acc:MGI:1914857]
zinc finger protein 80 Gene [Source:MGI Symbol;Acc:MGI:3704127]
zinc finger protein 873 Gene [Source:MGI Symbol;Acc:MGI:3040689]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10231 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10231
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145589 Nonsense 462 749 2 3
Genomic Location:
Chromosome 5 (position 72707296)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCAGTGCGGGAAGAGTTTCAGATGTTCATCAGCCCTAAATAAACACATG[A/T]WGATCCAYACTGGCGAGAAACCRTTCACATGTGTTCAATGCGGGACGAGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ogyxjbsa