cldn17

Ensembl ID:
ENSDARG00000092338
ZFIN ID:
ZDB-GENE-070821-2
Description:
claudin 17 [Source:RefSeq peptide;Acc:NP_001104000]
Human Orthologues:
CLDN17, CLDN8
Human Descriptions:
claudin 17 [Source:HGNC Symbol;Acc:2038]
claudin 8 [Source:HGNC Symbol;Acc:2050]
Mouse Orthologues:
Cldn17, Cldn8
Mouse Descriptions:
claudin 17 Gene [Source:MGI Symbol;Acc:MGI:2652030]
claudin 8 Gene [Source:MGI Symbol;Acc:MGI:1859286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42618 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42618
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000075785 Essential Splice Site None 335 3 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 41092926)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 42608182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAATTCTCAGTTTGTACTTTACAGCCATGTGATTTGGATCAAAATGAGG[G/A]TGAGTAAATAACCAGTTGTTAATAATAATAATAATAATGTTAATAATAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link