LOC100149932

Ensembl ID:
ENSDARG00000092322
Human Orthologue:
CD22
Human Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Mouse Orthologue:
Cd22
Mouse Description:
CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1988 Nonsense F2 line generated During 2016
sa39719 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1988
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133590 Nonsense 28 412 2 7
ENSDART00000147771 Nonsense 24 379 2 5
Genomic Location (Zv9):
Chromosome 1 (position 57393423)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56128527
GRCz10 1 56385078
KASP Assay ID:
554-2894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAAAAACTACAATGATATCTGTTTTTCAGKGGTTTCTRGTGCTGAYTG[G/A]GYTGTGAATTACAAATCTTTACACAWCTGTGCACTGAAGAACTCATCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39719
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133590 Essential Splice Site 301 412 4 7
ENSDART00000147771 Essential Splice Site 297 379 4 5
Genomic Location (Zv9):
Chromosome 1 (position 57394417)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56129521
GRCz10 1 56386072
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGACCATGGAGTGAAATACTCTGATCCTGTGACTTTAGATGTTCAGTG[T/C]GAGTAAATGATGGTTCAGTAACTGATATATTAAATCCTCTAAGTCTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link