si:ch211-250e5.2

Ensembl ID:
ENSDARG00000092312
ZFIN IDs:
ZDB-GENE-030131-4995, ZDB-GENE-030131-8384
Description:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase polypeptide 1-like [Source:RefSeq peptide;Acc:NP_
Human Orthologues:
B3GALNT1, B3GALT5
Human Descriptions:
beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) [Source:HGNC Symbol;Acc:918]
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 [Source:HGNC Symbol;Acc:920]
Mouse Orthologues:
B3galnt1, B3galt5
Mouse Descriptions:
UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5 Gene [Source:MGI Symbol;Acc:MGI:213
UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 Gene [Source:MGI Symbol;Acc:

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11579
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133494 Nonsense 180 367 2 2
Genomic Location (Zv9):
Chromosome 22 (position 26241054)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 25655499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGACTCTGAAAAAGCTCAACAGCAGCTGGAGAAAGAGAGCCGACAACAC[A/T]GAGATTTAATCCAGAGCAACTTTGTGGACTCCTATTTCAACCTGACCATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link