poldip2

Ensembl ID:
ENSDARG00000092305
ZFIN ID:
ZDB-GENE-030131-5881
Description:
polymerase delta-interacting protein 2 [Source:RefSeq peptide;Acc:NP_997879]
Mouse Orthologue:
Poldip2
Mouse Description:
polymerase (DNA-directed), delta interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1915061]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6377 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6377
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000078014 Essential Splice Site 270 376 8 11
ENSDART00000143137   None 205 None 7

The following transcripts of ENSDARG00000092305 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 15 (position 24039642)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24750829
KASP Assay ID:
554-4636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGTTTTTGTATGTCTACAGGAAGCTCARAACTCCCATGTGTATTGG[G/T]TAAGCAAARTTACCTGATTATGGCATTTGTAATGACTAAATAAAAGGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link