ENSDARG00000092293

Ensembl ID:
ENSDARG00000092293

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa26326 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa26326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136625 Essential Splice Site 101 214 3 4
Genomic Location (Zv9):
Chromosome 4 (position 33828844)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACACTGGAGAGAAACCATTCACATGCAACCAGTGTGGGAAGAGTTTCAG[C/T]CAAGAATCAAACCTTAATCTACACATGAGGATCCACATTGGAGAGAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link