si:ch73-197b13.1

Ensembl ID:
ENSDARG00000092258
ZFIN ID:
ZDB-GENE-081104-251
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLM8]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3193 Nonsense F2 line generated During 2017
sa5695 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3193
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147164   None 70 2 2
ENSDART00000148015 Nonsense 92 118 2 2
ENSDART00000147164   None 70 2 2
ENSDART00000148015 Nonsense 92 118 2 2
Genomic Location (Zv9):
Chromosome 22 (position 40954040)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38042341
KASP Assay ID:
554-3382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAAACCATCACACAGAAACACCGGCTTTCCCATCGCTGCCAAACACA[C/T]GAACTAAACGCCAAAGCAGAAGCAGGAGCGAGTCTGTGGTGAAAATGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5695
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147164   None 70 2 2
ENSDART00000148015 Nonsense 92 118 2 2
ENSDART00000147164   None 70 2 2
ENSDART00000148015 Nonsense 92 118 2 2
Genomic Location (Zv9):
Chromosome 22 (position 40954040)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 38042341
KASP Assay ID:
554-3382.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAAACCATCACACAGAAACACCGGCTTTCCCATCGCTGCCAAACACA[C/T]GAACTAAACGCCAAAGCAGAAGCAGGAGCGAGTCTGTGGTGAAAATGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link