ENSDARG00000092250

Ensembl ID:
ENSDARG00000092250

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24921 Nonsense Mutation detected in F1 DNA During 2015
sa28018 Essential Splice Site Mutation detected in F1 DNA During 2015

Mutation Details

Allele Name:
sa24921
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133756 Nonsense 262 625 4 11
Genomic Location:
Chromosome 12 (position 47330823)
KASP Assay ID:
554-7625.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGACACACCAGAGACGACCACAACAGAAACTACAATATCTATTTTCTA[C/A]ATAAATATAAATACCAGGGTCGGTCGTCGCTACAAAAAACTACCCCTCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28018
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133756 Essential Splice Site 368 625 7 11
Genomic Location:
Chromosome 12 (position 47329354)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATAAACAATTCAAGTAAAATAACAAATAAATTGTATATGTGTTGTCCGC[A/T]GGCCAACGGCAGCCACTTCATCTACAGTAACTATATTGTGGGGACGCCGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s2648hk4