irgf2

Ensembl ID:
ENSDARG00000092249
ZFIN ID:
ZDB-GENE-060503-460
Description:
Novel protein similar to mouse T-cell specific GTPase (Tgtp) [Source:UniProtKB/TrEMBL;Acc:A3QJW3]
Human Orthologues:
IRGC, IRGM
Human Descriptions:
immunity-related GTPase family, cinema [Source:HGNC Symbol;Acc:28835]
immunity-related GTPase family, M [Source:HGNC Symbol;Acc:29597]
Mouse Orthologues:
Ifi47, Irgc1
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9074 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9074
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141558 Nonsense 290 378 2 2
Genomic Location (Zv9):
Chromosome 19 (position 23796586)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 23726001
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTACAGTGAGTTTGGTCTGGATGATCWGAGTCTRCAGAAAYTCTGTGAA[C/T]GATCTGGGAAAACCATAGARGAACTGAAGAGTCTGATGAAGTCTCCCCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide association defines more than 30 distinct susceptibility loci for Crohn's disease. (View Study)
  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Crohn's disease: Sequence variants in the autophagy gene IRGM and multiple other replicating loci contribute to Crohn's disease susceptibility. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link