si:dkey-20i20.3

Ensembl ID:
ENSDARG00000092246
ZFIN ID:
ZDB-GENE-060503-623
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPU5]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25173 Nonsense Mutation detected in F1 DNA During 2017
sa39355 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25173
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131234 Nonsense 15 228 2 3
Genomic Location (Zv9):
Chromosome 22 (position 2063499)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2804589
KASP Assay ID:
554-7663.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGTAAATGCTGGAATATTCCCATCAGTCTACAAGTGAAGACGAGCAT[C/T]AGACCATCAGGAAGAAGAGAAATCTGCAAAGACAGAGTTTATTGAAGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39355
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131234 Nonsense 153 228 3 3
Genomic Location (Zv9):
Chromosome 22 (position 2064437)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2805527
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAATCACACATAAGGCTTCACACTGGAGAGAAACCTCACCAGTGTTCA[C/T]AATGCGGCAAGAGATTCAGTCATCCAGGAGTTCTAAAATCACACTTGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link