ENSDARG00000092244

Ensembl ID:
ENSDARG00000092244

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2144 Nonsense Mutation detected in F1 DNA During 2014
sa8107 Splice Site, Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132197 Nonsense 74 578 1 2
ENSDART00000141842 None None 309 None 3
Genomic Location:
Chromosome 3 (position 7674772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGAGAGAAACCATTCACATGCACTGAGTGTGGGAAGAGTTTCAGGCTGT[C/A]GCAACAACTTACTCATCACATGAGGATCCACACTGGAGAAAAACCATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132197 Splice Site None 578 None 2
ENSDART00000141842 Nonsense 43 309 2 3
Genomic Location:
Chromosome 3 (position 7664153)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGAGTAAAGAGGAGGAACATCATGTCAAAATTGAGGAAAAAAATAATTTA[C/T]AGACTTRCAGTATTTTGAAAAAGAGAGACAAGAAACCATTCACCTGCACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1thrrmtr