si:ch211-243a20.3

Ensembl ID:
ENSDARG00000092240
ZFIN ID:
ZDB-GENE-061207-28
Description:
hypothetical protein LOC100151507 [Source:RefSeq peptide;Acc:NP_001139181]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa404 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa404
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145486 Nonsense 183 186 4 4
Genomic Location (Zv9):
Chromosome 1 (position 45836846)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 44674358
KASP Assay ID:
554-0191.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAGCAGACGGGTGAAAGTGATCCAAAACGAAAGCAGAACGGTCAAAT[C/A]GAGTGAGAGGTAGATGGAGAGATGGAAGATTTGCAAATATTATCCTCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link