or111-9

Ensembl ID:
ENSDARG00000092238
ZFIN ID:
ZDB-GENE-010308-11
Description:
odorant receptor, family D, subfamily 111, member 9 [Source:RefSeq peptide;Acc:NP_571820]
Human Orthologues:
OR2AT4, OR6K2, OR6K3, OR6K6, OR6N1, OR6N2
Human Descriptions:
olfactory receptor, family 2, subfamily AT, member 4 [Source:HGNC Symbol;Acc:19620]
olfactory receptor, family 6, subfamily K, member 2 [Source:HGNC Symbol;Acc:15029]
olfactory receptor, family 6, subfamily K, member 3 [Source:HGNC Symbol;Acc:15030]
olfactory receptor, family 6, subfamily K, member 6 [Source:HGNC Symbol;Acc:15033]
olfactory receptor, family 6, subfamily N, member 1 [Source:HGNC Symbol;Acc:15034]
olfactory receptor, family 6, subfamily N, member 2 [Source:HGNC Symbol;Acc:15035]
Mouse Orthologues:
Olfr231, Olfr420, Olfr421, Olfr424, Olfr427, Olfr429, Olfr430, Olfr520, Olfr521
Mouse Descriptions:
olfactory receptor 231 Gene [Source:MGI Symbol;Acc:MGI:3030065]
olfactory receptor 420 Gene [Source:MGI Symbol;Acc:MGI:3030254]
olfactory receptor 421 Gene [Source:MGI Symbol;Acc:MGI:3030255]
olfactory receptor 424 Gene [Source:MGI Symbol;Acc:MGI:3030258]
olfactory receptor 427 Gene [Source:MGI Symbol;Acc:MGI:3030261]
olfactory receptor 429 Gene [Source:MGI Symbol;Acc:MGI:3030263]
olfactory receptor 430 Gene [Source:MGI Symbol;Acc:MGI:3030264]
olfactory receptor 520 Gene [Source:MGI Symbol;Acc:MGI:3030354]
olfactory receptor 521 Gene [Source:MGI Symbol;Acc:MGI:3030355]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28487 Splice Site Mutation detected in F1 DNA During 2015
sa11005 Nonsense Available for shipment Available now
sa17157 Nonsense Available for shipment Available now
sa12943 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa28487
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2015.
Mutation:
T > G
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060112 Splice Site None 277 None 6
ENSDART00000140456   None 314 None 1

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 15 (position 30710874)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTTGCCATTAAGATATCATGCTATTGTAAACAATTCCAGTATAACGT[T/G]AATTCTTTCAGCAAAATGGGCATTCAATTCTTCTATGGTGGCCTTGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11005
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060112   None 277 None 6
ENSDART00000140456 Nonsense 70 314 1 1
ENSDART00000060112   None 277 None 6
ENSDART00000140456 Nonsense 70 314 1 1
Genomic Location:
Chromosome 15 (position 30706128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACCGGAGTCTGCACAGTGCAAAGTACTTGTGTGTGTTTAACTTGGCCT[T/A]GGCTGATWTTGGTGARACTAATGCAGTGATTCCYAACATGTTGAAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17157
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060112   None 277 None 6
ENSDART00000140456 Nonsense 70 314 1 1
ENSDART00000060112   None 277 None 6
ENSDART00000140456 Nonsense 70 314 1 1
Genomic Location:
Chromosome 15 (position 30706128)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKACCGGAGTCTGCACAGTGCAAAGTACTTGTGTGTGTTTAACTTGGCCT[T/A]GGCTGATWTTGGTGARACTAATGCAGTGATTCCYAACATGTTGAAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000060112   None 277 None 6
ENSDART00000140456 Nonsense 99 314 1 1
Genomic Location:
Chromosome 15 (position 30706040)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGTTGAAGACTTTTCTGTTTGACTCTCAGTACWTCTCYTATAATGCTTG[T/A]TTGGCCAATATGTTTTTTGYGAACTACTTTATAAATGTRCAAAGTGCCAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oguxw34j