si:dkey-105j11.1

Ensembl ID:
ENSDARG00000092214
ZFIN ID:
ZDB-GENE-070705-276
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WVJ4]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa16101 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137587 Essential Splice Site 81 180 None 6

The following transcripts of ENSDARG00000092214 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 29112526)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29184783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGGCAGTGAGCCAGCACAAGCTTCTCAGACWGAACCAAAGCCGACGG[T/C]RAGTCTGAGATCTGGACATTTAGACAAATGTAAACAKTCTGGAACTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link