DACH2 (2 of 3)

Ensembl ID:
ENSDARG00000092177
Description:
dachshund homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:16814]
Human Orthologue:
DACH2
Human Description:
dachshund homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:16814]
Mouse Orthologue:
Dach2
Mouse Description:
dachshund 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1890446]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15153 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15153
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000144646 Nonsense 150 159 1 1

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 33623487)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 34623180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAWTCAGCCGGGCGTGAACCGGTGCAAACTCATCACCCGAAAAGACTTC[G/T]AGACACTTTATAACGACTGCACCAATGCCAGGCAAGTCTTAAATCACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link