si:dkey-147f3.8

Ensembl ID:
ENSDARG00000092166
ZFIN ID:
ZDB-GENE-061009-32
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3QJV1]
Human Orthologues:
FBXO44, FBXO6
Human Descriptions:
F-box protein 44 [Source:HGNC Symbol;Acc:24847]
F-box protein 6 [Source:HGNC Symbol;Acc:13585]
Mouse Orthologues:
Fbxo44, Fbxo6
Mouse Descriptions:
F-box protein 44 Gene [Source:MGI Symbol;Acc:MGI:1354744]
F-box protein 6 Gene [Source:MGI Symbol;Acc:MGI:1354743]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24281 Missense, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Missense, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133946   None 300 None 8
ENSDART00000137441 Missense 257 260 6 6
ENSDART00000145275 Nonsense 287 405 8 10

The following transcripts of ENSDARG00000092166 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 17078537)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 16981476
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCATTAAGTAACTTCTCTTATGTTCTCATTAGACGGACTTCAAGGATG[G/A]AAGATGGTACATAGTGGAAGCGGCTGCTGGGTGACAGCAGAAAATAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link