ank1

Ensembl ID:
ENSDARG00000092143
ZFIN ID:
ZDB-GENE-041010-44
Description:
ankyrin 1, erythrocytic [Source:RefSeq peptide;Acc:NP_001005969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14410 Nonsense Available for shipment Available now
sa14417 Nonsense Available for shipment Available now
sa2255 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa14410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
Genomic Location:
Chromosome 5 (position 71832259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917 None None 173 None 5
Genomic Location:
Chromosome 5 (position 71832259)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2255
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 None None 152 None 3
ENSDART00000132838 Nonsense 122 267 2 4
ENSDART00000141917 None None 173 None 5

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 71828137)
KASP Assay ID:
554-3440.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TARTTTTCTTTCTCATTTCTCAGGTTAAGCRCAGGGTCGTTCCTGTCTTA[T/A]CTGCAGGATCAGGGCTCTCCTGGTTGGCATTCGGCTGCAGAAGCGACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/gjvopyn6