ank1

Ensembl ID:
ENSDARG00000092143
ZFIN ID:
ZDB-GENE-041010-44
Description:
ankyrin 1, erythrocytic [Source:RefSeq peptide;Acc:NP_001005969]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14410 Nonsense Available for shipment Available now
sa14417 Nonsense Available for shipment Available now
sa40606 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa14410
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053   None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917   None 173 None 5
ENSDART00000109053   None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917   None 173 None 5
Genomic Location (Zv9):
Chromosome 5 (position 71832259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68156877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14417
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053   None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917   None 173 None 5
ENSDART00000109053   None 152 None 3
ENSDART00000132838 Nonsense 63 267 1 4
ENSDART00000141917   None 173 None 5
Genomic Location (Zv9):
Chromosome 5 (position 71832259)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68156877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTYGGAGAGTTCAGAAGGGGCTGTAGGTCRCCAAGTYACCAACAACATT[A/T]AARAYGGTTCCAATGGAGGTTTGGGAGAAGGAGGAGGTGACGGCACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40606
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109053 Nonsense 109 152 3 3
ENSDART00000132838   None 267 None 4
ENSDART00000141917 Nonsense 109 173 3 5

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 71811967)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68136585
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCATCTGTACACGTGGCTGATGTAGATTGTGAGGAAAGTGGTCCGG[A/T]GAGGAAAAGGGGAGGAAGGGGGTCAGGAGCTGATCATTGAAGGTCTGCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link