rad54b

Ensembl ID:
ENSDARG00000092134
ZFIN ID:
ZDB-GENE-060810-50
Human Orthologue:
RAD54B
Human Description:
RAD54 homolog B (S. cerevisiae) [Source:HGNC Symbol;Acc:17228]
Mouse Orthologue:
Rad54b
Mouse Description:
RAD54 homolog B (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:3605986]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42732 Essential Splice Site Mutation detected in F1 DNA During 2017
sa2853 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa42732
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138496 Essential Splice Site 327 917 6 15
Genomic Location (Zv9):
Chromosome 16 (position 28998703)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26874477
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAGAAAGAGGGCGTGGTCTTCCTTTACGAATGCTTAATGGGAATGAGG[T/G]AAATAAGAGTTGATCGGTTGTTGCTATGTTCTTCATATGCTCGTCTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2853
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138496 Nonsense 693 917 12 15
Genomic Location (Zv9):
Chromosome 16 (position 29002696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 26878470
KASP Assay ID:
554-2920.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCTTGACTTACTCCAGGACGTCTGTGATCAGATAGGCTATAAATGGTG[T/A]CGTCTTGATGGACAGACACCAGTTGGCCAGCGGCAGAAAATTGTTGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link