tomm40

Ensembl ID:
ENSDARG00000092112
ZFIN ID:
ZDB-GENE-030131-1365
Description:
translocase of outer mitochondrial membrane 40 [Source:RefSeq peptide;Acc:NP_955908]
Human Orthologue:
TOMM40
Human Description:
translocase of outer mitochondrial membrane 40 homolog (yeast) [Source:HGNC Symbol;Acc:18001]
Mouse Orthologue:
Tomm40
Mouse Description:
translocase of outer mitochondrial membrane 40 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:18582

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22847 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015302 Essential Splice Site 163 344 None 10
ENSDART00000132693 Essential Splice Site 179 278 None 8
ENSDART00000140539 Essential Splice Site 163 235 None 7

The following transcripts of ENSDARG00000092112 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 16 (position 27916505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGGTATTAGTGCACTGTTAATAAGGGCCTGTGTGAATGATGTGTTAC[A/T]GACACAGCAACACAAGTTTGTAAACTGGCAGTGTGATGGAGAGTATCGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3gwtfc3v