LOC100151204

Ensembl ID:
ENSDARG00000092091
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7603 Missense Mutation detected in F1 DNA During 2014
sa21072 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > G
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098924 Missense 31 493 1 9
Genomic Location:
Chromosome 7 (position 53577415)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTAYTTGCAAGTGAGAATTCRGCGACCCAAAGACTTTCCTCCTGGAC[C/G]TGCACCTGTTCCATTTTTTGGTAATTTGCTACAACTGAAYCGCWTAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098924 Nonsense 187 493 4 9
Genomic Location:
Chromosome 7 (position 53580080)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATCACCAAGCTGCCTCTAACATCATTGCCTCAGTCATTTTTGGGTCA[C/T]GATTTAATTACAAGGATGAATATTTTCAGACATTGATACAAACCATGGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/adbpgywv