si:dkey-20i20.15

Ensembl ID:
ENSDARG00000092073
ZFIN ID:
ZDB-GENE-060503-435
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV3]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37401 Nonsense Mutation detected in F1 DNA During 2017
sa37402 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37401
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131741 Nonsense 50 124 3 3
ENSDART00000134076 Nonsense 50 369 2 4
Genomic Location (Zv9):
Chromosome 22 (position 1933145)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2674235
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAGAAACATCAGGTCAAAAGTGAAGAAGAAACTCAATCAGAGACTGAA[C/T]AAACTATTTCAATGAAGAGAAAAGCAGTAAAATGTTTGACCTGCACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37402
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131741   None 124 None 3
ENSDART00000134076 Nonsense 183 369 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1935232)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2676322
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACCGTATTCATGTTTTGTGTGGAAAGAGTTTTAAACATCAGACTACAT[T/A]AAGACTACACCAGAGGATTCACACTGGAGAGGAGTTATTCATTTGCCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link