si:ch211-57k11.4

Ensembl ID:
ENSDARG00000092067
ZFIN ID:
ZDB-GENE-030131-426
Description:
Novel protein similar to vertebrate atrophin 1 (ATN1) [Source:UniProtKB/TrEMBL;Acc:A3KQ08]
Human Orthologue:
ATN1
Human Description:
atrophin 1 [Source:HGNC Symbol;Acc:3033]
Mouse Orthologue:
Atn1
Mouse Description:
atrophin 1 Gene [Source:MGI Symbol;Acc:MGI:104725]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133886   None 772 None 6
ENSDART00000140879 Nonsense 171 178 2 2
Genomic Location (Zv9):
Chromosome 16 (position 34077169)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31899653
KASP Assay ID:
554-0204.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGAATCGAGGGAGATTTGTCTCCCTTGAAGTCCTCAGCATCCCACTA[T/A]ACATCTCATCATGGAATGGTGGACAATACTAATGATCCAAGTAGCAACAG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link